|
|
| | Bepirovirsensodium Basic information |
| | Bepirovirsensodium Chemical Properties |
| form | Solid | | color | White to off-white |
| | Bepirovirsensodium Usage And Synthesis |
| Uses | Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3]. | | in vivo | Bepirovirsen sodium (22 and 50 mg/kg, s.c., twice weekly for week 1 and once weekly for weeks 2-4) reduces hepatic RNA transcripts, subsequent production of HBV DNA, and associated HBV serum antigens in HBV-transgenic mice[3].
| Animal Model: | HBV-transgenic mice[3] | | Dosage: | 22 and 50 mg/kg | | Administration: | s.c., twice weekly for week 1 and once weekly for weeks 2-4 | | Result: | Dose-dependently reduced hepatic expression of HBV RNA in HBV transgenic mice and reduced levels of all cytoplasmic hepatitis B core antigen in HBV-transgenic mice. |
| | References | [1] Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734. DOI:10.1038/s41591-021-01513-4 [2] Yuen MF, et al. Efficacy and Safety of Bepirovirsen in Chronic Hepatitis B Infection. N Engl J Med. 2022 Nov 24;387(21):1957-1968. DOI:10.1056/NEJMoa2210027 [3] Han K, et al. Preclinical and Phase 1 Assessment of Antisense Oligonucleotide Bepirovirsen in Hepatitis B Virus-Transgenic Mice and Healthy Human Volunteers: Support for Clinical Dose Selection and Evaluation of Safety, Tolerability, and Pharmacokinetics of Single and Multiple Doses. Clin Pharmacol Drug Dev. 2022 Oct;11(10):1191-1202. DOI:10.1002/cpdd.1154 |
| | Bepirovirsensodium Preparation Products And Raw materials |
|